Angaben zur Quelle [Bearbeiten]
| Autor | Flavio Rizzolio |
| Titel | PIN1, the cell cycle control and cancer: a new player in the RB pathway |
| Ort | Siena |
| Jahr | 2010 |
| Anmerkung | University of Siena, Ph.D in Oncology and Genetics |
| URL | http://www3.unisi.it/ricerca/dottorationweb/genetica_medica/Tesi/Rizzolio%20PhD%20thesis.pdf |
Literaturverz. |
no |
| Fußnoten | no |
| Fragmente | 10 |
| [1.] Rlm/Fragment 030 Fig4 - Diskussion Zuletzt bearbeitet: 2014-12-10 23:33:13 Singulus | Fragment, Gesichtet, KomplettPlagiat, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop |
|
|
|
| Untersuchte Arbeit: Seite: 30, Zeilen: Fig. 4 |
Quelle: Rizzolio 2010 Seite(n): 30, Zeilen: Fig. 1 |
|---|---|
| Fig 4: The different roles of PIN1 in cellular physiology | Fig. 1. The different roles of PIN1 in cellular physiology |
Identical, no source given. Continued on next page (see [Rlm/Fragment_031_01]). |
|
| [2.] Rlm/Fragment 031 01 - Diskussion Zuletzt bearbeitet: 2014-12-04 21:04:49 Singulus | Fragment, Gesichtet, KomplettPlagiat, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop |
|
|
|
| Untersuchte Arbeit: Seite: 31, Zeilen: 1 ff. (entire page) |
Quelle: Rizzolio 2010 Seite(n): 29, 30, 31, Zeilen: 29: 7 f.f - 30:1-2.5 ff. - 31:1-3 |
|---|---|
| PIN1 is a member of the evolutionarily conserved peptidylprolyl isomerase (PPIase) family of proteins. PIN1 has a two-domain structure that consists of an N-terminal WW domain (amino acids 1–39) and the Cterminal PPIase domain (amino acids 45–163). The WW domain binds only to specific pSer/Thr-Pro-motifs and the PPIase isomerase domain catalyzes the conformational switch from cis to trans of target proteins. This fact is especially important because Pro-directed kinases and phosphatases are conformation-specific and act only on the trans isoform (55,56). For this reason, PIN1 is important for many physiological activities of the cell (Fig. 4).
In cell cycle control, PIN1 was originally identified and defined as a protein important in mitosis (57). Depletion of PIN1 in yeast and human cells induces mitotic arrest and its over-expression blocks the cells in the G2 phase of the cell cycle (51). Since the discovery of PIN1, a plethora of protein targets have been discovered, many of which are involved in the G0 and G1/S control (58). PIN1 controls Cyclin D1 mRNA levels and it is involved in regulation of CyclinD1, c-MYC and Cyclin E protein stability. PIN1 -/- MEF showed proliferative defects in cell cycle entry after serum deprivation. In addition, PIN1 is a target of E2F transcription factors and its mRNA and protein levels fluctuate during cell cycle [(59).] 51)Lu, K. P., Hanes, S. D., and Hunter, T. A human peptidyl-prolyl isomerase essential for regulation of mitosis. Nature (Lond.), 380: 544–547, 1996. 55) Lu, K.P., et al., Prolyl cistrans isomerization as a molecular timer. Nat Chem Biol, 2007. 3(10): p. 619‐29. 56) Lu, K.P. and X.Z. Zhou, The prolyl isomerase PIN1: a pivotal new twist in phosphorylation signalling and disease. Nat Rev Mol Cell Biol, 2007. 8(11): p. 904‐16. 57) Shen, M., et al., The essential mitotic peptidylprolyl isomerase Pin1 binds and regulates mitosisspecific phosphoproteins. Genes Dev, 1998. 12(5): p. 706‐20. 58) Yeh, E.S. and A.R. Means, PIN1, the cell cycle and cancer. Nat Rev Cancer, 2007. 7(5): p. 381‐8. 59) Ryo, A., et al., PIN1 is an E2F target gene essential for Neu/Rasinduced [sic] transformation of mammary epithelial cells. Mol Cell Biol, 2002. 22(15): p. 5281‐95. |
[Page 29]
PIN1 is a member of the evolutionarily conserved peptidylprolyl isomerase (PPIase) family of proteins. PIN1 has a two-domain structure that consists of an N-terminal WW domain (amino acids 1–39) and the Cterminal PPIase domain (amino acids 45–163). The WW domain binds only to specific pSer/Thr-Pro-motifs and the PPIase isomerase domain catalyzes the conformational switch from cis to trans of target proteins. This fact is especially important because Pro-directed kinases and phosphatases are conformation-specific and act only on the trans isoform [3, 4]. For this reason, PIN1 is important for many physiological activities of the cell (Fig. 1). [Page 30] In cell cycle control, PIN1 was originally identified and defined as a protein important in mitosis. Many of PIN1’s substrates contain a single phosphorylation target in the form of CDC25, WEE1 and RPB1[15]. Others, like CK2 and Sil, have multi-phosphorylation sites, suggesting a different mechanism in PIN1 function [16, 17]. Depletion of PIN1 in yeast and human cells induces mitotic arrest and its over-expression blocks the cells in the G2 phase of the cell cycle [14]. Since the discovery of PIN1, a plethora of protein targets have been discovered, many of which are involved in the G0 and G1/S control [11]. Evidence emerged from in vitro and in vivo animal models. PIN1 controls Cyclin D1 mRNA levels and it is involved in regulation of CyclinD1, c-MYC and Cyclin E protein stability [5, 11]. PIN1 -/- MEF showed [Page 31] proliferative defects in cell cycle entry after serum deprivation. In addition, PIN1 is a target of E2F transcription factors and its mRNA and protein levels fluctuate during cell cycle [18]. 3. Lu, K.P., et al., Prolyl cistrans isomerization as a molecular timer. Nat Chem Biol, 2007. 3(10): p. 619‐29. 4. Lu, K.P. and X.Z. Zhou, The prolyl isomerase PIN1: a pivotal new twist in phosphorylation signalling and disease. Nat Rev Mol Cell Biol, 2007. 8(11): p. 904‐16. 11. Yeh, E.S. and A.R. Means, PIN1, the cell cycle and cancer. Nat Rev Cancer, 2007. 7(5): p. 381‐8. 14. Lu, K.P., S.D. Hanes, and T. Hunter, A human peptidyl-prolyl isomerase essential for regulation of mitosis. Nature, 1996. 380(6574): p. 544‐7. 15. Shen, M., et al., The essential mitotic peptidylprolyl isomerase Pin1 binds and regulates mitosisspecific phosphoproteins. Genes Dev, 1998. 12(5): p. 706‐20. 16. Messenger, M.M., et al., Interactions between protein kinase CK2 and Pin1. Evidence for phosphorylation-dependent interactions. J Biol Chem, 2002. 277(25): p. 23054‐64. 17. Campaner, S., et al., Sil phosphorylation in a Pin1 binding domain affects the duration of the spindle checkpoint. Mol Cell Biol, 2005. 25(15): p. 6660‐72. 18. Ryo, A., et al., PIN1 is an E2F target gene essential for Neu/Ras-induced transformation of mammary epithelial cells. Mol Cell Biol, 2002. 22(15): p. 5281‐95. |
Although identical, nothing has been marked as a citation. Starting with reference 55), again the formatting of references changes in Rlm so that it becomes exactly like that of the unnamed source. "Neu/Rasinduced" (missing hyphen) is a copy-and-paste-mistake. |
|
| [3.] Rlm/Fragment 032 01 - Diskussion Zuletzt bearbeitet: 2014-12-04 21:07:09 Singulus | Fragment, Gesichtet, KomplettPlagiat, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop |
|
|
|
| Untersuchte Arbeit: Seite: 32, Zeilen: 1-4 |
Quelle: Rizzolio 2010 Seite(n): 31, Zeilen: 8-10 |
|---|---|
| Even in cancer pathology, PIN1 over-expression was found in 38 different tumour types out of 60, including most common human cancers such as prostate, cervical, brain, ovary, lung, breast, liver cancer, and melanoma . | In cancer pathology, PIN1 over-expression was found in 38 different tumour types out of 60, including most common human cancers such as prostate, cervical, brain, ovary, lung, breast, liver cancer, and melanoma [8].
8. Bao, L., et al., Prevalent overexpression of prolyl isomerase Pin1 in human cancers. Am J Pathol, 2004. 164(5): p. 1727‐37. |
Although identical, nothing has been marked as a citation. Continued from previous page. |
|
| [4.] Rlm/Fragment 035 09 - Diskussion Zuletzt bearbeitet: 2014-12-04 21:09:59 Singulus | Fragment, Gesichtet, KomplettPlagiat, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop |
|
|
|
| Untersuchte Arbeit: Seite: 35, Zeilen: 9-17 |
Quelle: Rizzolio 2010 Seite(n): 45, Zeilen: 7 ff. |
|---|---|
| In a GST gene fusion system, the GST sequence is incorporated into an expression vector alongside the gene sequence encoding the protein of interest. Induction of protein expression from the vector's promoter results in expression of a fusion protein. This GST-fusion protein can then be purified from cells via its high affinity for glutathione. It is fused to the N-terminus of a protein. Agarose beads can be coated with glutathione, and such glutathione-Agarose beads bind GST-proteins. These beads are then washed, to remove contaminating bacterial proteins. | In a GST gene fusion system, the GST sequence is incorporated into an expression vector alongside the gene sequence encoding the protein of interest. Induction of protein expression from the vector's promoter results in expression of a fusion protein. This GST-fusion protein can then be purified from cells via its high affinity for glutathione. It is fused to the N-terminus of a protein. Agarose beads can be coated with glutathione, and such glutathione-Agarose beads bind GST-proteins. These beads are then washed, to remove contaminating bacterial proteins. |
Although identical, nothing has been marked as a citation. No source given. |
|
| [5.] Rlm/Fragment 036 02 - Diskussion Zuletzt bearbeitet: 2014-12-04 22:00:31 Singulus | Fragment, Gesichtet, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop, Verschleierung |
|
|
|
| Untersuchte Arbeit: Seite: 36, Zeilen: (1), 2 ff. |
Quelle: Rizzolio 2010 Seite(n): 47, Zeilen: 1-5 |
|---|---|
| Fig:5a Possible site of ineraction between Pin1 and AR
Fig5b: In vitro and in vivo interaction between PIN1 and AR a) Potential PIN1 binding site targets in AR protein. b) GST-PIN1 interaction with AR. A specific band was detected in the GST-PIN1 lane and no band is detected in GST control lane. |
Fig. 6. In vitro and in vivo interaction between PIN1 and pRb. a) Potential PIN1 binding site targets in pRb protein. b) GST-PIN1 interaction with pRb. A specific band was detected in the GST-PIN1 lane and no band is detected in GST control lane. Of note, the band corresponds to the high molecular weight of phospho-pRb. As a control, the membrane was
probed with anti GST antibody. |
Slightly adapted to the case at hand; still, nothing has been marked as a citation. The "blind" take-over of text leads to a confusing legend (what does the "a)" stand for in the legend of "Fig5b"?). Continued on the following page. |
|
| [6.] Rlm/Fragment 037 04 - Diskussion Zuletzt bearbeitet: 2014-12-05 18:59:03 Singulus | Fragment, Gesichtet, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop, Verschleierung |
|
|
|
| Untersuchte Arbeit: Seite: 37, Zeilen: 4-7, 9-15 |
Quelle: Rizzolio 2010 Seite(n): 48, Zeilen: 1-9 |
|---|---|
| To assess the in vivo interaction between PIN1 and AR, LNCaP cells were immunoprecipitated with anti-PIN1 antibody and analyzed by western blot with anti-AR antibody. [...]
Co-immunoprecipitation is a purification procedure to determine if two different proteins interact. An antibody specific to the protein of interest is added to a cell lysate. Then the antibody-protein complex is pelleted usually using protein-A/G agarose, which binds most antibodies. If there are any proteins that bind to the first protein, they will also be pelleted. Identification of proteins in the pellet can be determined by western blot. |
To assess the in vivo interaction between PIN1 and pRb, T98G cells were immunoprecipitated with anti-PIN1 antibody and analyzed by western blot with anti-pRb antibody.
Co-immunoprecipitation is a purification procedure to determine if two different proteins interact. An antibody specific to the protein of interest is added to a cell lysate. Then the antibody-protein complex is pelleted usually using protein-A/G agarose, which binds most antibodies. If there are any proteins that bind to the first protein, they will also be pelleted. Identification of proteins in the pellet can be determined by western blot. |
Slightly adapted to the situation at hand, but otherwise identical. Nothing has been marked as a citation. |
|
| [7.] Rlm/Fragment 052 02 - Diskussion Zuletzt bearbeitet: 2014-12-05 18:52:59 SleepyHollow02 | Fragment, Gesichtet, KeineWertung, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel |
|
|
|
| Untersuchte Arbeit: Seite: 52, Zeilen: 2-11, 13-14 |
Quelle: Rizzolio 2010 Seite(n): 61, 64-65, Zeilen: 61:9-12; 64:19-22 - 65:1-3 |
|---|---|
| Plasmids
shRNA plasmids Pin1 (SHCLNG-NM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelop plasmid (12259) and PwPI (12254) were from Addgene Inc, Cambridge, MA, USA. For overexpression experiments, the IMAGE: 3941595 clone was utilized to amplify the Pin1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI adaptor sequences, respectively. The plasmid was sequenze verified. GST pull-down experiment: the PCR generated Pin1 (PIN1-BamHIF and PIN1-EcoRIR) were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA). |
[Page 61]
shRNA plasmids for pRB (SHCLNG-NM_000321), PIN1 (SHCLNGNM_006221) were from Sigma Inc., St Louis, MO, USA. Scrambled shRNA (17920), psPAX2 packaging plasmid (12260), pMDG.2 envelope plasmid (12259) were from Addgene Inc, Cambridge, MA, USA. [Page 64] For GST pull-down experiment, the IMAGE: 3941595 clone was utilized to amplify the PIN1 human gene with the oligonucleotide primers PIN1-BamHIF GCGGATCCGCGGCAGGAGGGAAGATGG at the 5’ end and PIN1-EcoRIR GCGAATTCCTGGGCTCCCCACCCTCAC at the 3’ with BamHI and EcoRI [Page 65] adaptor sequences, respectively. The PCR generated products were ligated in the pGEX-2T plasmid for the prokaryotic expression vector (Stratagene Inc., La Jolla CA, USA). |
Adapted, but still in many parts identical. |
|
| [8.] Rlm/Fragment 054 11 - Diskussion Zuletzt bearbeitet: 2014-12-05 19:02:52 Singulus | Fragment, Gesichtet, KomplettPlagiat, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop |
|
|
|
| Untersuchte Arbeit: Seite: 54, Zeilen: 11-17 |
Quelle: Rizzolio 2010 Seite(n): 60, Zeilen: 12-18 |
|---|---|
| Lentiviral production
To generate knock down cells, lentiviral particles were produced as described (http://www.broadinstitute.org/genome_bio/trc/publicProtocols.html). Briefly, 1x106 293FT cells (Invitrogen Corp, Carlsbad, CA, USA) were transfected with 2.25 μg of PAX2 packaging plasmid, 0.75 μg of PMD2G envelop plasmid and 3μg of pLKO.1 hairpin vector utilizing [30 μl of Fugene HD (Roche Applied Science, Indianapolis, IN, USA) in 10 cm plate.] |
Lentiviral production
To generate knock down cells, lentiviral particles were produced as described (http://www.broadinstitute.org/genome_bio/trc/publicProtocols.html). Briefly, 1x106 293FT cells (Invitrogen Corp, Carlsbad, CA, USA) were transfected with 2.25 μg of PAX2 packaging plasmid, 0.75 μg of PMD2G envelop plasmid and 3μg of pLKO.1 hairpin vector utilizing 30 μl of Fugene HD (Roche Applied Science, Indianapolis, IN, USA) in 10 cm plate. |
Although identical, nothing has been marked as a citation. Continued on the next pages. |
|
| [9.] Rlm/Fragment 055 01 - Diskussion Zuletzt bearbeitet: 2014-12-05 19:04:14 Singulus | Fragment, Gesichtet, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop, Verschleierung |
|
|
|
| Untersuchte Arbeit: Seite: 55, Zeilen: 1-2, 4-8, 10-18 |
Quelle: Rizzolio 2010 Seite(n): 60-61, 65, Zeilen: 60:14-18.19-21 - 61:1-2; 65:3-11 |
|---|---|
| [Briefly, 1x106 293FT cells (Invitrogen Corp, Carlsbad, CA, USA) were transfected with 2.25 μg of PAX2 packaging plasmid, 0.75 μg of PMD2G envelop plasmid and 3μg of pLKO.1 hairpin vector utilizing] 30 μl of Fugene HD (Roche Applied Science, Indianapolis, IN, USA) in 10 cm plate. Polyclonal populations of Pin1 kd and scrambled cells were generated by infection with 1 MOI (multiplicity of infectious) of shRNA lentiviral particles. 2.5x105 cells were plated in a multi 6 wells plate. The day after, the cells were transduced with 1 MOI of lentiviral particle in 10% FBS MEM medium. After 3 days post-infection, the cells were selected with 2 μg/ml of puromycin (Sigma-Aldrich, St Louis, MO, USA) for 1 week [sic]
Pull-down analyses GST and GST-Pin1 proteins were produced in BL21 bacteria cells. Cells were grown to mid log phase and then induced to express protein by adding 0.25mM of isopropyl-1-thio-b-D-galactopyranoside (IPTG, Roche Applied Science, Indianapolis, IN, USA). The cultures were shaken for 4 h; bacteria were then pelleted and resuspended in NENT buffer (20mM Tris (pH 8), 100mM NaCl, 1mM ethylenediaminetetraacetic acid (EDTA), 0.5% NP-40). Cell suspensions were sonicated and pelleted so that the supernatant could be collected. |
[Page 60]
Briefly, 1x106 293FT cells (Invitrogen Corp, Carlsbad, CA, USA) were transfected with 2.25 μg of PAX2 packaging plasmid, 0.75 μg of PMD2G envelop plasmid and 3μg of pLKO.1 hairpin vector utilizing 30 μl of Fugene HD (Roche Applied Science, Indianapolis, IN, USA) in 10 cm plate. The lentivirus were collected and filtered (45um) after 48 hours. 2.5x105 T98G cells were plated in a multi 6 wells plate. The following day, the cells were transduced with 1 MOI of lentiviral particle in 10% FBS DMEM medium. After 3 days post-infection, the [Page 61] cells were selected with 2 μg/ml of puromycin (Sigma-Aldrich, St Louis, MO, USA) for 1 week. [Page 65] GST and GST-PIN1 proteins were produced in BL21 bacteria cells. Cells were grown to mid log phase and then induced to express protein by adding 0.25mM of isopropyl-1-thio-b-D-galactopyranoside (IPTG, Roche Applied Science, Indianapolis, IN, USA). The cultures were shaken for 4 h; bacteria were then pelleted and resuspended in NENT buffer (20mM Tris (pH 8), 100mM NaCl, 1mM ethylenediaminetetraacetic acid (EDTA), 0.5% NP-40). Cell suspensions were sonicated and pelleted so that the supernatant could be collected. |
Although nearly identical, nothing has been marked as a citation. Continued from previous page. |
|
| [10.] Rlm/Fragment 056 01 - Diskussion Zuletzt bearbeitet: 2014-12-05 19:06:54 Singulus | Fragment, Gesichtet, Rizzolio 2010, Rlm, SMWFragment, Schutzlevel sysop, Verschleierung |
|
|
|
| Untersuchte Arbeit: Seite: 56, Zeilen: 1-15 |
Quelle: Rizzolio 2010 Seite(n): 65-66, Zeilen: 65:11-17.(17-19).20-22 - 66:1-5 |
|---|---|
| The remaining bacteria were then resuspended in NENT buffer plus 2% of N-lauryl-sarcosine, then pelleted and finally, the supernatants were collected again. The combined supernatants were incubated with glutathione agarose beads (Sigma Inc., St Louis, MO, USA) overnight at 4 oC. The agarose was then pelleted and washed three times in NENT buffer. The GST protein was analyzed by electrophoresis gel and blue coomassie staining. 1mg of protein was pulled-down with 10 ug of GST or GST-Pin1.
Co-immunoprecipitation assay Sub-confluent LNcaP cells were harvested and proteins were prepared as follows: the cell pellet was resuspended in lysis buffer (20 mM Tris HCl pH 8, 137 mM NaCl, 10% glycerol, 1% NP40, 2 mM EDTA). 1mg of proteins was immunoprecipitated, utilizing 4 μg of PIN1, AR antibody or mouse IgG overnight at 4°C Extracts were incubated with antibodies and protein A/G beads (Pierce) for 3 h at 4°C. |
[Page 65]
The remaining bacteria were then resuspended in NENT buffer plus 2% of N-lauryl-sarcosine, then pelleted and finally, the supernatants were collected again. The combined supernatants were incubated with glutathione agarose beads (Sigma Inc., St Louis, MO, USA) overnight at 4 oC. The agarose was then pelleted and washed three times in NENT buffer. The GST protein was analyzed by electrophoresis gel and blue coomassie staining. 1mg of protein was pulled-down with 10 ug of GST or GST-PIN1. To dephosphorylate proteins, 1mg of protein lysate was treated with 50 U of shrimp alkaline phosphatase for 1h at 37 oC. Co-immunoprecipitation assay Sub-confluent T98G cells were harvested and nuclear/cytoplasmatic proteins were prepared as follows: the cell pellet was resuspended in NP40 lysis [Page 66] buffer (0.01M Tris-HCl, 0.01M NaCl, 0.003M MgCl2, 0.03M Sucrose, 0.5% NP40) to prepare the cytoplasmatic fraction. Afterwards, nuclei were pelleted and resuspended in lysis buffer (20 mM Tris HCl pH 8, 137 mM NaCl, 10% glycerol, 1% NP40, 2 mM EDTA). 1mg of proteins was immunoprecipitated, utilizing 4 μg of PIN1 antibody. |
Although nearly identical, nothing has been marked as a citation. Continued from previous page. |
|